Comparative biology

Results: 889



#Item
111Biology / Genomics / Genetics / Molecular evolution / Genetic mapping / Bioinformatics / Genome / Evolution / Comparative genomics / Horizontal gene transfer / Gene duplication / Gene

Scientific Report First name / Family name Nationality Name of the Host Organisation First Name / family name

Add to Reading List

Source URL: fellowship.ercim.eu

Language: English - Date: 2013-02-11 08:41:46
112Biology / Genetics / Bioinformatics / Genomics / Genetic mapping / Human evolution / Human genetics / Human genome / Conserved sequence / Noncoding DNA / Genome / Comparative genomics

GGTGCCAGGGAAAGGGCAGGAGGTGAGTGCTGGGAGGCAGCTGAGGTCAACTTCTTTTGAACTTCCACGTGGTATTTACTCAGAGCAATTGGTGCCAGAG GCTCAGGGCCCTGGAGTATAAAGCAGAATGTCTGCTCTCTGTGCCCAGACGTGAGCAGGTGAGCAGCTGGGGCGAAAGACCTGTTGGAGGCTATGAATGC AATCAAGGTGACAGACAA

Add to Reading List

Source URL: bejerano.stanford.edu

Language: English - Date: 2009-04-17 16:28:41
113Biology / Medicine / Clinical medicine / Biotechnology / Biomarkers / Chemical pathology / Cetuximab / Comparative genomic hybridization / PDX / Pathology

An array of opportunities for translational research r ce n ca t i‐ u g s

Add to Reading List

Source URL: www.oncodesign.com

Language: English - Date: 2012-12-05 06:25:30
114Biology / Genetics / Genomics / DNA / Molecular biology / Genome / Comparative genomics / Noncoding DNA / Intron / Exon / Molecular evolution / Bioinformatics

Genome Indices database 1 Integration of Biological Features of Multiple Genomes - The Construction of “Genome Indices” database Shujiro Okuda

Add to Reading List

Source URL: www.jsbi.org

Language: English - Date: 2004-06-07 22:06:09
115Genomics / Genetics / Biology / Omics / Metagenomics / Transcriptome / Comparative genomics / Bioinformatics / Population genomics / Genome / Molecular evolution

workshop on genomics europe 2012 Monday, January 9, 12

Add to Reading List

Source URL: evomicsorg.wpengine.netdna-cdn.com

Language: English - Date: 2012-01-09 14:20:08
116Biology / Genetics / Bioinformatics / Genomics / Genetic mapping / DNA / Molecular biology / Human genome / Genome / Gene / Comparative genomics / David Haussler

Efficient Exact p-Value Computation and Applications to Biosequence Analysis

Add to Reading List

Source URL: bejerano.stanford.edu

Language: English - Date: 2006-10-29 03:12:06
117Biology / Molecular biology / Biotechnology / Bioinformatics / Computational biology / DNA / Netherlands Bioinformatics Centre / DNA sequencing / Research in Computational Molecular Biology / International Society for Computational Biology / Comparative genomics / Single-nucleotide polymorphism

Scientific Report First name / Family name Murray PATTERSON

Add to Reading List

Source URL: fellowship.ercim.eu

Language: English - Date: 2014-01-30 08:42:00
118Chemistry / Biology / Bioinformatics / Carbohydrate chemistry / Biological databases / Carbohydrates / ABC transporters / Protein families / KEGG / Glycosylation / ATP-binding cassette transporter / Glycan

Comparative genome analysis of glycan transporters Yoshinobu Igarashi Shin Kawano Susumu Goto

Add to Reading List

Source URL: www.jsbi.org

Language: English - Date: 2004-06-07 21:47:26
119Biology / Zoology / Embryology / Physiology / Aquatic ecology / Developmental biology / Fisheries / Fish physiology / Anamniotes / Embryo / Comparative physiology / Amphibian

Ecological and Environmental Physiology of Vertebrate Eggs, Embryos and Larvae

Add to Reading List

Source URL: www.eeps-oxford.com

Language: English - Date: 2006-06-09 16:40:28
120Biology / Molecular biology / Cellular processes / Molecular genetics / Gene expression / Meiosis / Saccharomyces cerevisiae / Schizosaccharomyces pombe / Gene / Cell cycle / Regulation of gene expression / Ridge

Comparative Analysis of Conditional Regulation Across the Yeast Genomes Koji Ota Susumu Goto

Add to Reading List

Source URL: www.jsbi.org

Language: English - Date: 2005-01-18 01:09:37
UPDATE